90
|
Synthego Inc
synthetic sgrna targeting hek3 (ggcccagactgagcacgtga) Synthetic Sgrna Targeting Hek3 (Ggcccagactgagcacgtga), supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic sgrna targeting hek3 (ggcccagactgagcacgtga)/product/Synthego Inc Average 90 stars, based on 1 article reviews
synthetic sgrna targeting hek3 (ggcccagactgagcacgtga) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
synthetic sgrna Synthetic Sgrna, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic sgrna/product/GenScript corporation Average 90 stars, based on 1 article reviews
synthetic sgrna - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Synthego Inc
synthetic sgrnas harboring 2′-o-methyl analogs 3′-phosphorothioate nonhydrolyzable linkages Synthetic Sgrnas Harboring 2′ O Methyl Analogs 3′ Phosphorothioate Nonhydrolyzable Linkages, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic sgrnas harboring 2′-o-methyl analogs 3′-phosphorothioate nonhydrolyzable linkages/product/Synthego Inc Average 90 stars, based on 1 article reviews
synthetic sgrnas harboring 2′-o-methyl analogs 3′-phosphorothioate nonhydrolyzable linkages - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Synthego Inc
chemically modified single guide rna (sgrna) that targets rat g6pd exon 5 Chemically Modified Single Guide Rna (Sgrna) That Targets Rat G6pd Exon 5, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chemically modified single guide rna (sgrna) that targets rat g6pd exon 5/product/Synthego Inc Average 90 stars, based on 1 article reviews
chemically modified single guide rna (sgrna) that targets rat g6pd exon 5 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Biospring
synthetic chemically modified sgrna Synthetic Chemically Modified Sgrna, supplied by Biospring, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic chemically modified sgrna/product/Biospring Average 90 stars, based on 1 article reviews
synthetic chemically modified sgrna - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Synthego Inc
synthetic sgrna targeting hbb locus  Synthetic Sgrna Targeting Hbb Locus, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic sgrna targeting hbb locus/product/Synthego Inc Average 90 stars, based on 1 article reviews
synthetic sgrna targeting hbb locus - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Synthego Inc
synthetic sgrna with 2′- o -methyl phosphorothioate modification Synthetic Sgrna With 2′ O Methyl Phosphorothioate Modification, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic sgrna with 2′- o -methyl phosphorothioate modification/product/Synthego Inc Average 90 stars, based on 1 article reviews
synthetic sgrna with 2′- o -methyl phosphorothioate modification - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
TriLink
modified sgrnas rag2 and ccr5 Modified Sgrnas Rag2 And Ccr5, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/modified sgrnas rag2 and ccr5/product/TriLink Average 90 stars, based on 1 article reviews
modified sgrnas rag2 and ccr5 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Synthego Inc
synthetic sgrnas te buffer Synthetic Sgrnas Te Buffer, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic sgrnas te buffer/product/Synthego Inc Average 90 stars, based on 1 article reviews
synthetic sgrnas te buffer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
synthetic sgrna targeting cerk Synthetic Sgrna Targeting Cerk, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic sgrna targeting cerk/product/GenScript corporation Average 90 stars, based on 1 article reviews
synthetic sgrna targeting cerk - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Synthego Inc
synthetic cbl-b sgrna Synthetic Cbl B Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic cbl-b sgrna/product/Synthego Inc Average 90 stars, based on 1 article reviews
synthetic cbl-b sgrna - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Synthego Inc
synthetic sgrna p2ry12  Synthetic Sgrna P2ry12, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/synthetic sgrna p2ry12/product/Synthego Inc Average 90 stars, based on 1 article reviews
synthetic sgrna p2ry12 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell Reports
Article Title: Controlled Cycling and Quiescence Enables Efficient HDR in Engraftment-Enriched Adult Hematopoietic Stem and Progenitor Cells
doi: 10.1016/j.celrep.2020.108093
Figure Lengend Snippet:
Article Snippet: Briefly, 75pmol of Cas9-NLS (UC Berkeley, Berkeley, CA) was mixed slowly into Cas9 buffer (20mM HEPES (pH 7.5), 150mM KCl, 1mM MgCl 2 , 10% glycerol and 1mM TCEP) containing 75pmol of
Techniques: Recombinant, Staining, Amplification, Sequencing, Software
Journal: Journal of visualized experiments : JoVE
Article Title: Screening Sperm for Rapid Isolation of Germline Edits in Zebrafish
doi: 10.3791/64686
Figure Lengend Snippet: Table of Materials
Article Snippet:
Techniques: Construct, Purification, Sequencing, Electrophoresis, Nucleic Acid Electrophoresis, Imaging, Staining, Isolation